153.  Строение ротовых аппаратов насекомых зависит от:
а) употребляемой пищи; +
б) способа питания; +
в) способа добычи пищи;
г) образа жизни;
д) развития пищеварительной системы.

154.  Скрытый резерв наследственной изменчивости образует мутации:
а) геномные;
б) генные доминантные;
в) хромосомные;
г) генные рецессивные. +

155.  Факторами-поставщиками эволюционного материала являются:
а) мутационный процесс, дрейф генов, волны численности; +
б) борьба за существование, естественный отбор;
в) волны численности, изоляция, дрейф генов;
г) дрейф генов, естественный отбор, изоляция.

156.  Эволюция человека как биологического вида:
а) не происходит, т. к. благодаря развитию медицины естественный отбор в популяциях человека не действует;
б) продолжается, т. к. отбор в популяциях человека идет, он фактор сохранения генофонда, сдерживания распространения мутаций; +
в) невозможна, т. к. все расы человека принадлежат к одному виду и между ними нет генетической изоляции, а географическая изоляция стирается в связи с активной миграцией населения;
г) совершается очень медленно, т. к. в генофонде встречаются только рецессивные мутации.


157.  Для географического способа видообразования характерно:
а) обострение внутривидовой конкуренции, расхождение популяций по разным экологическим нишам в пределах прежнего ареала;
б) расширение ареала, появление физических преград между популяциями, возникновение мутаций, действие естественного отбора; +
в) возникновение мутаций, действие естественного отбора на популяции без расширения ареала;
г) обитание отдельных групп особей в разных экологических условиях.

158.  Из следующих клеточных структур не содержит нуклеиновую кислоту:
а) митохондрия;
б) ядро;
в) шероховатый эндоплазматический ретикулум;
г) гладкий эндоплазматический ретикулум. +

159.  Цианид (CN–) вызывает гибель живых существ:
а) остановкой фотосинтеза;
б) разрушением белковых молекул;
в) остановкой b-окисления;
г) остановкой переноса электрона по электронно-транспортной цепи (ЭТЦ). +

160.  Атомы кислорода, используемые для образования Н20 на конечном этапе окислительного фосфорилирования (также называемом конечным окислением), происходят от:
а) двуокиси углерода;
б) глюкозы;
в) молекулярного кислорода; +
г) пирувата.


161.  Во время репликации в эукариотических клетках удаление праймеров:
а) осуществляется ферментом только с ДНК-азной активностью;
б) происходит при образовании фрагментов Оказаки;
в) происходит только в отстающих цепях;
г) происходит только в ядре. +

162.  Следующая последовательность отмечена в геномном банке данных как часть кодирующего локуса в геноме:
5’…..AGGAGGTAGCACCTTTATGGGGAATGCATTAAACA…….3’
Подчеркнутый участок ATG представляет собой инициирующий кодон гена, локализованного в этом локусе. Из следующих последовательностей частью транскрибированной м-РНК, соответствующей этому локусу, может быть:
а) 5’ AGGAGGUAGCACCUUUAUGGGGAAUGCAUUAAACA 3’; +
б) 5’ UCCUCCAUCGUGGAAAUACCCCUUACGUAAUUUGU 3’;
в) 5’ ACAAAUUACGUAAGGGGUAUUUCCACGAUGGAGGA 3’;
г) 5’ UGUUUAAUGCAUUCCCCAUAAAGGUGCUACCUCCU 3’.

163.  Последовательность органелл, вовлеченных в синтез и секрецию модифицированных белков в эукариотических клетках, следующая:
а) рибосома, эндоплазматический ретикулум, аппарат Гольджи, клеточная мембрана; +
б) рибосома, аппарат Гольджи, эндоплазматический ретикулум, клеточная мембрана;
в) митохондрия, рибосома, эндоплазматический ретикулум, клеточная мембрана;
г) ядро, митохондрия, рибосома, аппарат Гольджи, клеточная мембрана.

164.  В эксперименте по изучению того, какая часть листьев капусты, съеденных гусеницей, превращается в ее биомассу, было установлено, что гусеница съедает в день 2 cм2 листьев.


я определения этого превращения были проведены следующие измерения:
W –средний сухой вес 2 cм2 листьев, соответствующих съеденному за день;
X – общий вес фекалий гусеницы в день;
Y – сухой вес фекалий гусеницы в день;
Z – вес двуокиси углерода, образуемой гусеницей за день.
Исходя из этих измерений, была бы правильной для определения веса капустных листьев, превращенных в биомассу гусеницы, следующая формула:
а) W – X – Z;
б) W – Y – Z; +
в) 2W – X – содержание углерода в Z;
г) W + X – Y.

165.  Тот факт, что все семь признаков огородного гороха, изучаемых Менделем, подчинялись принципу независимого наследования, означает, что:
а) гаплоидный набор хромосом огородного гороха равен 7;
б) образование гамет у растений происходит только путем митоза;
в) семь пар аллелей, определяющих эти признаки, ведут себя так, как если бы они находились в различных хромосомах; +
г) семь пар аллелей, определяющих эти признаки, находятся в одной и той же паре гомологичных хромосом.

166.  Родители имеют генотипы AABBCc и AabbCc, с полным доминированием и независимым наследованием по трем парам признаков. Какова будет доля потомства, имеющего фенотип первого родителя, после их скрещивания?
а) 1/4;
б) 3/4; +
в) 1/8;
г) 3/8.

167.  Гены A и B сцеплены на расстоянии 12 единиц карты. Какое соотношение между гаметами можно ожидать от гетерозиготного организма, родители которого имели генотипы AАbb и aaBB:
а) 44% AB; 6% Ab; 6% aB; 44 % ab;
б) 6% AB; 44 % Ab; 44 % aB; 6 % ab; +
в) 12 % AB; 38 % Ab; 38 % aB; 12 % ab;
г) 6% AB; 6 % Ab; 44% aB; 44 % ab.

iv>

168.  Какое из приведенных ниже различных дигибридных скрещиваний между мышами предоставляет наилучшую возможность получить в одном помете мышь с генотипом AABb:
а) AaBb x AaBb;
б) AaBb x AABb; +
в) AABB x aaBb;
г) AaBb x AaBB.

169.  Две особи одного вида отличаются по одному признаку. При их скрещивании между собой были получены особи только с родительскими фенотипами, подсчет которых был произведен. Из нижеприведенных соотношений между двумя наблюдаемыми фенотипами потомства находится в соответствии с гипотезой single gene difference (признак, контролируемый одним геном):
а) 421/416; +
б) 862/281;
в) 762/435;
г) 1201/304.

170.  Учитывая, что линия животных является чистой в отношении определенного признака:
а) скрещивание особей этой линии не позволит дальнейшую селекцию вариантов этого признака; +
б) потомство от таких экспериментов по скрещиванию будет состоять исключительно из гомозигот по любому взятому локусу, включая локус, ответственный за этот признак;
в) скрещивание представляется невозможным, так как постоянно возникает стерильность;
г) скрещивание особей этой линии является путем получения гибридов по этому признаку.


171.  Из следующих ниже утверждений согласуется с законом Харди-Вайнберга:
а) в экосистеме, находящейся в состоянии климакса, поток энергии постоянный;
б) в панмиктической популяции частота аллелей остается постоянной от поколения к поколению; +
в) в высоких широтах индивидуумы более высокие;
г) в популяции частота мутирования компенсирует давление отбора.

172.  В эволюции высших растений можно наблюдать следующие эволюционные направления:
а) возрастающую доминантность спорофита и редукцию гаметофитного поколения. +
б) возрастающую доминантность гаметофита, которая сопровождается развитием сосудов и ситовидных трубок с сопровождающими клетками у покрытосеменных;
в) возрастающую доминантность спорофита, которая сопровождается развитием трахеид и ситовидных трубок с альбуминовыми клетками у покрытосеменных;
г) возрастающую доминантность спорофита, тогда как гаметофит остается без изменений.

173.  Из приведенных ниже утверждений для гемоглобина справедливо:
а) повышение концентрации ионов Н+ в крови снижает сродство гемоглобина к О2; +
б) повышение рН крови снижает сродство гемоглобина к О2;
в) повышение концентрации СО2 в крови повышает сродство гемоглобина к О2;
г) снижение концентрации СО2 в крови снижает сродство гемоглобина к О2.

174.  По некоторым меркам волос человека растет относительно медленно – со скоростью около 20 см в год.

>
на роста находится у основания волоса, где в клетках эпидермиса синтезируются a-кератиновые нити, скручивающиеся затем наподобие канатов. Основным структурным элементом a-кератина является a-спираль, шаг которой составляет 0,54 нм, а на виток приходится 3,6 аминокислотных остатков. Исходя из того, что фактором, лимитирующим рост волос, служит биосинтез a-спиральных цепей кератина, можно вычислить, что скорость образования пептидных связей в цепях a-кератина (число связей в 1 с), которая могла бы обеспечить наблюдаемое удлинение волос за 1 год, равна примерно:
а) 15;
б) 20;
в) 40; +
г) 50.

175.  Сладкий вкус зерен в свежесобранных початках кукурузы обусловлен высоким содержанием в них сахара. Кукуруза, которую продают через несколько дней после сбора, имеет более низкую сахаристость, так как половина свободного сахара в зернах превращается в крахмал в течение одного дня хранения. Чтобы сохранить сладкий вкус свежесобранной кукурузы, очищенные початки помещают на несколько минут в кипящую воду, а затем охлаждают. Кукуруза, обработанная таким способом и хранящаяся в замороженном виде сохраняет свой сладкий вкус. Биологическая основа этой обработки состоит в том, что:
а) при нагревании активируется фермент, гидролизующий крахмал с образованием свободного сахара;
б) при нагревании инактивируется фермент, ответственный за превращение сахара в крахмал; +
в) крахмал быстро гидролизуется при повышенных температурах;
г) при высоких температурах в клетке резко активируется синтез свободных сахаров.


176.  Метанол (древесный спирт) очень токсичен: прием внутрь всего лишь 30 мл может привести к смерти. Такая необычайно высокая токсичность метанола обусловлена действием не столько самого метанола, сколько продукта его метаболизма – формальдегида. Метанол быстро окисляется под действием фермента печени алкогольдегидрогеназы:
NAD+ + CH3OH ® NADH + H+ + H2C=O (формальдегид)
Один из методов лечения при отравлении метанолом состоит в том, что больному назначают этанол (этиловый спирт) либо внутрь, либо внутривенно в количествах, которые у здорового человека вызывают интоксикацию. Объясните почему такое лечение оказывается эффективным?
а) из-за избытка этанола в крови метанол начинает быстрее выводиться почками с мочой;
б) образующийся формальдегид взаимодействует с этанолом с образованием нетоксичного продукта (полуацеталя);
в) этанол конкурирует с метанолом за активный центр алкогольдегидрогеназы; +
г) этанол в больших количествах сильно снижает активность алкогольдегидрогеназы, препятствуя тем самым образованию токсичного формальдегида.

177.  Люди, обладающие группой крови IV (О) являются при ее переливании:
а) универсальными донорами;
б) универсальными реципиентами; +
в) универсальными донорами и реципиентами;
г) не могут предоставлять кровь для переливания.

178.  Наибольшее количество тепла в организме млекопитающих и человека вырабатывается:
а) легкими;
б) желудком;
в) печенью; +
г) поджелудочной железой.


179.  В толстом кишечнике в процессе жизнедеятельности микроорганизмов синтезируются витамины:
а) А и D;
б) С и В12;
в) В12 и К; +
г) А и К.

180.  Когда человек получает какую-либо травму, например, перелом ноги, то мобилизует аминокислоты, сахара и жиры, для использования их в длительном ответе на стресс, гормон:
а) ацетилхолин;
б) кортизол; +
в) альдостерон;
г) адреналин.

181.  Когда рабочая пчела жалит в целях самозащиты, ее жало часто застревает в теле жертвы, что приводит к смерти пчелы. Допустив, что для пчелы защита является актом самоубийства, как вы могли бы объяснить продолжительность существования такого поведения:
а) медоносные пчелы агрессивны по природе;
б) иногда жало не застревает в теле противника и пчела может повторно использовать свое оружие;
в) выгодой для данной семьи; +
г) поскольку пчелы, чаще выступающие на защиту от врагов извне улья, являются также самыми старыми и практически на границе продолжительности своей жизни.

182.  Известно, что птицы часто моногамны, а млекопитающие полигамны. Это можно объяснить тем, что:
а) самки, пригодные для спаривания, более часто встречаются у млекопитающих;
б) млекопитающие, но не птицы, демонстрируют себя на токовищах;
в) внешнее оплодотворение у птиц требует присутствия самца во избежание конкурентов за оплодотворение вновь отложенных яиц;
г) кормление молоком у млекопитающих делает вклад самцов в заботу о потомстве менее необходимым. +


183.  Птицы, относящиеся к воробьиным, могут издавать различные виды звуков и сигналов тревоги. Песни самцов этих птиц отличаются от вида к виду. Они выполняют главным образом, две основные функции: защиту территории и привлечение/стимулирование самок к спариванию. Крики тревоги издаются, когда птицы замечают опасного хищника, пролетающего над ними. Крики тревоги при виде пролетающего сокола стимулируют находящихся рядом птиц прятаться. В то время, как песни самцов различаются у различных видов, крики тревоги у некоторых видов совпадают по звучанию, т. е. они имеют некоторые общие акустические свойства. Объяснение такого сходства криков тревоги у птиц разных видов, может быть следующим:
а) это конвергентная эволюция криков тревоги, поскольку их акустические свойства создают трудности хищнику для определения местонахождения кричащей птицы; +
б) это конвергентная эволюция криков тревоги, поскольку их акустические свойства разрешают издающему крик точно локализовать пролетающего над ними хищника;
в) это конвергентная эволюция криков тревоги с простыми акустическими свойствами, поскольку молодые птицы легче и быстрее выучивают простые крики тревоги.
г) хищники исчезают, услышав длительные крики, поскольку такие же крики издаются их собственными хищниками.


184.  Достоверным доказательством сцепления генов является то, что:
а) два гена находятся вместе в одной и той же гамете;
б) данный ген связан со специфическим фенотипом;
в) гены не расщепляются во время мейоза; +
г) один ген влияет на два признака.

185.  Дарвиновская приспособленность организма измеряется:
а) количеством его потомков, которые выживают для воспроизводства; +
б) количеством партнеров, которых он привлекает;
в) его физической силой;
г) продолжительностью его жизни.

186.  Допустив, что при мейозе происходит только независимое распределение признаков (и не происходит кроссинговер), можно предположить, что тригибрид производит следующее количество различных типов гамет:
а) 4;
б) 8; +
в) 2 x 23;
г) 6.

187.  Эдафон – это:
а) прибор, предназначенный для отпугивания насекомых при помощи звуковых волн;
б) совокупность всех обитателей почвы; +
в) часть звукового органа саранчи;
г) звуковой аппарат комара.

188.  Виды рыб могут жить и размножаться в одном водоеме, но не скрещиваться между собой. Это пример предзиготной изоляции посредством:
а) экологической изоляции;
б) поведенческой изоляции;
в) механической изоляции;
г) сезонной изоляции. +

189.  Потенциальной опасностью для изолированной популяции, где число особей сильно уменьшено, является:
а) потеря генетического разнообразия; +
б) тенденция к избирательному спариванию;
в) рост численности особей;
г) нарушение закона Харди-Вайнберга.

190.  Гортань образована:
а) хрящевыми прокладками;
б) хрящевыми полукольцами;
в) крупными хрящами, соединенными мышцами и связками; +
г) мелкими хрящами с прикрепленными к ним мышцами.

191.  Реснитчатый эпителий выстилает:
а) все воздухоносные пути; +
б) только носовую полость;
в) только гортань и трахею;
г) только бронхи.

192.  Витаминов организму человека в сутки необходимо в количестве:
а) от нескольких мгк до нескольких мг; +
б) от нескольких мг до нескольких граммов;
в) от одного до двух граммов одних и до десяти граммов других;
г) до миллиграммов одних и до десяти граммов других.

193.  При выращивании рассады, в целях лучшей приживаемости растений, желательно:
а) пользоваться торфоперегнойными горшочками; +
б) высевать семена с 50% запасом;
в) использовать почву худшего состава, чем у основной после высадки;
г) отказаться от полива рассады на 5 дней перед высадкой.

194.  С помощью светового микроскопа можно наблюдать, что при потере воды растительные клетки сжимаются меньше, чем животные. Причина этого явления связана с:
а) подвижностью плазмалеммы;
б) числом пор в плазмалемме;
в) осмотическим потенциалом клетки;
г) наличие целлюлозной оболочки у растительной клетки. +

195.  Укажите, какая из следующих полостей имеет целомическое происхождение:
а) полость легких;
б) полость мочевого пузыря;
в) брюшная полость; +
г) полость матки.

196.  Характерной чертой пресмыкающихся является:
а) сухая кожа с эпидермальными производными и кожным дыханием;
б) дыхание только при помощи легких и постоянная температура тела;
в) развитие включает откладывание яиц и стадию личинки;
г) дыхательная система включает трахеи и легкие. +

197.  Нити митотического веретена представляют собой:
а) микрофиламенты;
б) целлюлозные волокна;
в) промежуточные филаменты;
г) микротрубочки. +

198.  В интерфазном ядре отсутствуют:
а) микротрубочки; +
б) хроматин;
в) ядерные поры;
г) ДНК-полимеразы.

199.  Какая структура клетки не участвует в синтезе АТФ:
а) цитоплазма;
б) ядро; +
в) митохондрии;
г) хлоропласты.

200.  Выберите правильные суждения:

Строение ротовых аппаратов насекомых зависит от образа жизни.

Приспособление к ночному образу жизни у животных выражается прежде всего в строении глаза. +

Евстахиева труба – канал, сообщающий среднее ухо земноводных с глоткой. +

Латимерия – последний вымерший вид кистепёрых рыб.

Аутотомия – это отламывание хвоста ящериц. +

Клетки спороносного слоя грибов являются диплоидными.

Мицелий почти всех грибов преимущественно дикариотический.

Все вены несут кровь к сердцу. +

Все беспозвоночные используют внешнее оплодотворение.

Беспозвоночные не вступают в копуляцию. +

Рибосомы имеются в клетках всех живых организмов. +

Тромбоциты образуются в селезенке.

Мозжечок – центр координации движения позвоночных животных. +

Животный мир моря отличается чрезвычайным богатством группами высшего систематического ранга — типами и классами. +

Сыворотка – плазма крови, не содержащая фибриногена.

201.  Из перечисленных веществ в прокариотах отсутствуют:
а) фруктоза;
б) аргинин;
в) тимин;
г) холестерин. +

202.  Селен нужен живым организмам для:
а) образования структурных белков;
б) синтеза ферментов; +
в) компактной упаковки ДНК;
г) синтеза РНК.

203.  Кобальт входит в состав:
а) гормонов;
б) витаминов; +
в) нуклеотидов;
г) полисахаридов.

204.  Наименьшее количество энергии, при расчете на одну молекулу вещества, клетка получает при:
а) окислении жиров;
б) анаэробном расщеплении углеводов;
в) гидролизе АТФ; +
г) аэробном расщеплении углеводов.

205.  Какой из процессов не может происходить в анаэробных условиях:
а) гликолиз;
б) синтез белка;
в) окисление жиров; +
г) синтез АТФ.

206.  Какая из РНК могла образоваться при транскрипции ДНК с последовательностью нуклеотидов АТГЦГГАТАТТЦТГТГГА:
а) ЦГЦАУЦУГЦА;
б) УАЦГААУАГАЦЦУ;
в) УЦЦАЦАГААУ; +
г) УЦГУАЦГЦЦУ.

207.  Информационная РНК бактерий:
а) содержит на 5′ конце модифицированный нуклеотид (кэп);
б) содержит информацию для синтеза нескольких белков; +
в) не имеет участков присоединения белков-репрессоров;
г) несет на 5′ конце последовательность адениловых нуклеотидов.

208.  У человека карие глаза доминируют над серыми, а полидактилия (шестипалость) — над пятипалостью, причем гены обоих признаков находятся на аутосомах. Кареглазый пятипалый юноша женился на сероглазой шестипалой девушке. От этого брака родился сероглазый шестипалый мальчик и пятипалая кареглазая девочка. Вероятность рождения в этой семье сероглазого пятипалого мальчика составляет:
а) 0,25;
б) 0,5;
в) 0,125; +
г) 0,375.

209.  Наследственная близорукость – доминантный признак, а дальтонизм — рецессивное заболевание, сцепленное с полом. От брака близорукого дальтоника с нормальной женщиной родилась дочь-дальтоник, не больная близорукостью. Вероятность рождения от этого брака близорукого сына, не больного дальтонизмом:
а) 0,25;
б) 0,5;
в) 0,125; +
г) 0,375.

210.  У человека альбинизм обусловлен рецессивным аутосомным геном, а дальтонизм – рецессивным геном, сцепленным с полом. У здоровой супружеской пары родился сын-альбинос, страдающий дальтонизмом. Вероятность рождения в этой семье девочки с нормальным зрением и пигментацией кожи:
а) 0,25;
б) 0,5;
в) 0,125;
г) 0,375. +

211.  Личинки–кровососы у таких членистоногих, как:
а) тараканы;
б) иксодовые клещи; +
в) блохи;
г) мухи-жигалки.

212.  Понятие “автогенность членистоногих” наиболее полно характеризует:
а) развитие порции яиц одновременно и параллельно с перевариванием крови;
б) возможность кровососания без откладки яиц; +
в) развитие порции яиц без кровососания;
г) повторные кровососания в течение одного гонотрофического цикла.

213.  Видовой состав блох можно определить по стадии развития:
а) личинка;
б) имаго; +
в) куколка;
г) яйцо.

214.  Образ жизни, характерный для водяной полевки:
а) круглогодичное наземное обитание около водоёмов;
б) вселение на зиму в подвалы домов с повреждением запасов овощей; +
в) вселение на зиму в подвалы домов с повреждением запасов круп;
г) постоянное отсутствие в постройках человека.

215.  Даже при голодании улитки остаются еще некоторое время зелеными. Только после длительного голодания они приобретают коричнево-желтый цвет. Ученые исследовали потерю веса (wl) голодающей улитки. Сравнивая голодающую зеленую (gr) с голодающей коричнево-желтой (by) улиткой, они могли получить следующие результаты:
а) wl(gr) = 0 ; wl(by) > 0;
б) wl(gr) > 0 ; wl(by) = 0;
в) wl(gr) > 0 ; wl(by) > 0;
г) wl(by) > wl(gr) > 0. +

216.  У плаунов ветвление:
а) боковое;
б) дихотомическое;
в) верхушечное; +
г) симподиальное.

217.  Глиальные макрофаги осуществляют функцию:
а) защитную; +
б) секреторную;
в) трофическую;
г) опорную.

218.  Синоним подвижного соединения костей в скелете человека – это:
а) синхондроз;
б) синостоз;
в) диартроз; +
г) синартроз.

219.  Сложная система приспособительных механизмов, обеспечивающая текучесть крови в сосудах и свертывание ее при нарушении их целостности – это:
а) гемолиз;
б) гематокрит;
в) гемостаз; +
г) гомеостаз.

220.  При выработке условного пищевого рефлекса у собаки, пища:
а) является условным раздражителем;
б) является индифферентным раздражителем;
в) является безусловным раздражителем; +
г) в зависимости от характера опыта может быть как условным, так и безусловным раздражителем.

221.  Инсулин секретируется следующими клетками поджелудочной железы:
а) А – клетками;
б) В – клетками; +
в) С – клетками;
г) Д – клетками.

222.  Нерв, обеспечивающий поворот глазного яблока у человека:
а) тройничный;
б) отводящий; +
в) лицевой;
г) зрительный.

223.  Минимальное парциальное давление С02 в процессе дыхания в организме человека наблюдается в:
а) альвеолярном воздухе; +
б) тканях;
в) составе венозной крови;
г) составе артериальной крови.

224.  Энтерокиназа – специфический фермент, вырабатываемый:
а) железами стенки желудка;
б) слюнными железами;
в) поджелудочной железой;
г) железами стенки тонкого кишечника. +

225.  Процесс расщепления гликогена с образованием свободной глюкозы называется:
а) гликогенолиз; +
б) гликогенез;
в) гликемия;
г) гликолиз.

226.  К приобретенной программе поведения у животных относят:
а) динамический стереотип; +
б) тропизм;
в) инстинкт;
г) безусловный рефлекс.

227.  Разрушителями костной ткани в организме являются следующие клетки:
а) остеокласты; +
б) хондроциты;
в) фиброциты;
г) лейкоциты.

228.  Лучезапястный сустав по форме является:
а) мыщелковым;
б) седловидным;
в) эллипсовидным; +
г) шаровидным.

229.  Из клеток эпидермиса у человека способны к размножению только клетки слоя:
а) базального; +
б) блестящего;
в) рогового;
г) зернистого.

230.  У кого из упомянутых в приведенном перечне людей в первую очередь гипертрофирован только правый желудочек:
а) больные бронхиальной астмой; +
б) ловцы жемчуга;
в) спортсмены;
г) больные гипертонической болезнью.

231.  При дегидратации организма в первую очередь возбуждаются:
а) хеморецепторы;
б) осморецепторы; +
в) механорецепторы;
г) фоторецепторы.

232.  В норме в крови человека не должен находиться:
а) восстановленный гемоглобин;
б) оксигемоглобин;
в) карбаминогемоглобин;
г) карбгемоглобин. +

233.  Под влиянием адреналина образование глюкокортикоидов в коре надпочечников:
а) всегда усиливается; +
б) всегда уменьшается;
в) не изменяется;
г) в зависимости от концентрации может, как усиливаться, так и уменьшаться.

234.  Клапаны сердца образуются за счет выростов:
а) миокарда;
б) эндокарда; +
в) перикарда;
г) эпикарда.

235.  Стенка желудка состоит из четырех слоев, которые располагаются в следующей последовательности:
а) подслизистый – мышечный – серозный – слизистый;
б) слизистый – подслизистый – мышечный – серозный; +
в) мышечный – серозный – слизистый – подслизистый;
г) серозный – мышечный – слизистый – подслизистый.

236.  Витамины A и D можно применять сразу за один прием в таком количестве, которого достаточно для поддержания их нормального уровня в течение нескольких недель. Витамины же группы В необходимо принимать значительно чаще, так как:
а) витамины A и D практически не разрушаются в организме человека;
б) витамины A и D могут депонироваться в печени и других тканях; +
в) витамины A и D очень медленно расходуются в организме, в отличие от витаминов группы В;
г) высокая растворимость витаминов группы В в крови приводит к их быстрому выведению из организма, в отличие от витаминов A и D; +
д) витамины А и D, будучи водорастворимыми, быстрее всасываются в кровь, но медленнее расходуются в организме.

237.  К парным железам внутренней секреции относят железу:
а) щитовидную;
б) надпочечник; +
в) половую; +
г) поджелудочную;
д) паращитовидную. +

238.  Поджелудочная железа вырабатывает следующие гормоны:
а) инсулин; +
б) лизоцим;
в) трипсин;
г) глюкагон; +
д) адреналин.

239.  Синтез АТФ происходит в:
а) цитоплазме; +
б) лизосомах;
в) хлоропластах; +
г) ядре;
д) митохондриях. +

240.  Липиды входят в состав:
а) рибосом;
б) митохондрий; +
в) хроматина;
г) ядрышка;
д) аппарата Гольджи. +

241.  Нуклеиновые кислоты в живых организмах могут выполнять следующие функции:
а) структурную ; +
б) запасающую;
в) хранение информации; +
г) активный транспорт через мембраны;
д) каталитическую. +

242.  РНК содержится в:
а) цитоплазматической мембране;
б) гладком эндоплазматическом ретикулуме;
в) шероховатом эндоплазматическом ретикулуме; +
г) аппарате Гольджи;
д) ядре. +

243.  Аппарат Гольджи участвует в:
а) биосинтезе полипептидных цепей;
б) модификации полипептидных цепей; +
в) секреции белков; +
г) формировании некоторых клеточных органелл; +
д) синтезе АТФ.

244.  Биосинтез белка осуществляется в:
а) микротрубочках;
б) ядрышке;
в) митохондриях; +
г) цитоплазме; +
д) лизосомах.

245.  В качестве транспортной формы углеводов живые организмы используют:
а) крахмал;
б) глюкозу; +
в) гликоген;
г) сахарозу; +
д) мальтозу.

246.  В световой фазе фотосинтеза образуются:
а) глюкоза;
б) кислород; +
в) АТФ; +
г) пировиноградная кислота;
д) рибулозодифосфат.

247.  Конечными продуктами цикла Кребса являются:
а) лимонная кислота;
б) вода;
в) углекислый газ; +
г) НАД. Н; +
д) ГТФ. +

248.  В состав среднего уха входит:
а) молоточек; +
б) слуховая (евстахиева) труба; +
в) полукружные каналы;
г) наружный слуховой проход;
д) стремя. +

249.  Крахмал может образовываться в:
а) вакуолях;
б) лейкопластах; +
в) цитоплазме;
г) митохондриях;
д) хлоропластах. +

250.  Непосредственными предшественниками РНК являются:
а) АТФ; +
б) ГДФ;
в) АМФ;
г) ЦТФ; +
д) тимидин.

251.  Клеточная ДНК находится в:
а) цитоплазме;
б) ядре; +
в) митохондриях; +
г) лизосомах;
д) рибосомах.

252.  Отрицательно заряжены молекулы следующих веществ:
а) жиров;
б) РНК; +
в) гистонов;
г) ДНК; +
д) крахмала.

253.  В корне участки камбия, возникшие из производных перицикла НЕ способны откладывать:
а) сосуды первичной ксилемы; +
б) паренхиму;
в) ситовидные трубки вторичной флоэмы; +
г) сосуды вторичной ксилемы; +
д) ситовидные трубки первичной флоэмы. +

254.  Сухие плоды многоорешки характерны для:
а) таволги; +
б) рябины;
в) гравилата; +
г) лапчатки; +
д) клена.

255.  Среди положений о факторах и результатах эволюции к синтетической теории эволюции относятся:
а) видообразование — длительный, постепенный процесс, идущий путем дивергенции;
б) видообразование совершается не только постепенно, но и внезапно, путем полиплоидии, хромосомных перестроек; +
в) на популяцию оказывают влияние мутационный процесс, волны численности, дрейф генов, изоляция, естественный отбор; +
г) естественный отбор происходит на основе мелких наследственных изменений; +
д) причиной прогрессивных изменений является внутреннее стремление организма к совершенствованию.

256.  Теории естественного отбора противоречат утверждения:
а) эволюция совершается только на основе случайного комбинирования мутаций; +
6) дрейф генов, вопреки естественному отбору, может удерживать в генофонде малых популяций мутации, снижающие жизнеспособность особей;
в) эволюция идет на основе отбора случайных мелких наследственных изменений;
г) эволюция происходит на основе закономерности: изначально присущей организмам направленной наследственной изменчивости; +
д) борьба за существование – следствие естественного отбора.

257.  Примерами экологического способа видообразования могут служить:
а) образование в пойме нижней Волги видов житняка, щетинника, костра, дающих семена до разлива реки и после него; +
б) образование на океанических островах бескрылых насекомых;
в) возникновение карликовой лошади (пони) на Шетландских островах;
г) нерест пяти популяций севанской форели в различное время года; +
д) появление пяти видов синиц в связи с пищевой специализацией. +

258.  принадлежат следующие положения о происхождении жизни на Земле:
а) биологической эволюции предшествовала длительная химическая эволюция соединений углерода;
б) жизнь — явление космическое, живое происходит только от живого; +
в) жизнь возникла в форме клеток (организмов) одного вида;
г) жизнь организована экосистемно, всегда существовала в форме биосферы; +
д) жизнь на Земле возникла абиогенным путем.

259.  Является ли клетка прокариотической или эукариотической можно заключить на основании следующих признаков:
а) генетический материал существует в виде комплекса нуклеиновых кислот с белками;
б) генетический материал отделен от остального содержимого клетки ядерной мембраной; +
в) имеется клеточная стенка;
г) клетка подвижна;
д) клетка использует в качестве источника энергии H2S. +

260.  В тонком кишечнике человека при отсутствии желчи значительно снижается всасывание:
а) дипептидов;
б) жирорастворимых витаминов; +
в) крахмала;
г) глюкозы;
д) аминокислот.

261.  Для осуществления газообмена у всех животных необходимы:
а) тонкие и влажные поверхности; +
б) диффузия; +
в) красные кровяные тельца;
г) гемоглобин или другие дыхательные пигменты;
д) органы дыхания.

262.  У рыб с замкнутым плавательным пузырем после первичного наполнения газом извне дальнейшее изменение количества и состава газов происходит путем его выделения и поглощения кровью. Это относится к следующим рыбам:
а) карп; +
б) окунь;
в) колюшка;
г) карась; +
д) сельдь. +

263.  При спокойном выдохе воздух «покидает» легкие, потому что:
а) уменьшается объем грудной клетки; +
б) сокращаются мышечные волокна в стенках легких;
в) диафрагма расслабляется и выпячивается в грудную полость; +
г) расслабляются мышцы грудной клетки;
д) сокращаются мышцы грудной клетки.

264.  Соотнесите каждый структурный компонент с соответствующей ей выполняемой функцией.

1. Лейкопласты

2. Шероховатый ЭР

3. Геном

4. Митохондрии

5. Центриоль

6. Мезосома

7. Лизосома

8. Микрофиламент

9. Гладкий ЭР

10. Аппарат Гольджи

a.  Цикл Кребса

b.  Прикрепление бактериальной ДНК

c.  Центр организации микротрубочек

d.  Модификация и созревание белков

e.  Полный набор генетической информации

f.  Запасание крахмала

g.  Иммуноглобулин

h.  Синтез липидов

i.  Цитоскелет

j.  Пищеварительные ферменты

265.  Гриб лишайника получает от водоросли:
воду;
минеральные соли;
органические вещества; +
воздух.

266.  Эндосперм голосеменного растения:
гаплоидный; +
диплоидный;
триплоидный;
имеет неклеточное строение.

267.  Запасающую функцию в зерновках выполняет ткань:
покровная;
проводящая;
основная; +
образовательная.

268.  У плаунов ветвление:
боковое;
дихотомическое;
верхушечное; +
симподиальное.

269.  Женским гаметофитом у покрытосеменных растений является:
семяпочка;
пестик;
пыльцевая трубка;
зародышевый мешок. +

270.  Придаточные почки побега могут быть расположены на:
листе или в пазухе листа;
листе и междоузлии; +

271.  листе и верхушке побега;
верхушке побега и в пазухе листа.

272.  В металлургии, пиротехнике и медицине раньше применяли споры:
папоротников;
мхов;
хвощей;
плаунов. +

273.  Вещества, придающие окраску лепесткам венчика цветка, в основном содержатся в:
цитоплазме;
оболочке;
ядре;
клеточном соке. +

Все беспозвоночные используют внешнее оплодотворение Из за большого объема этот материал размещен на нескольких страницах:
1 2 3 4 5

Источник: pandia.ru

Половые клетки

У животных половое размножение включает слияние двух разных гамет, образующих зиготу. Гаметы производятся типом деления клеток, называемым мейозом. Гаметы гаплоидны (содержат только один набор хромосом ), тогда как зигота диплоидна (содержит два набора хромосом). В большинстве случаев мужская гамета (сперматозоид) является подвижной и обычно имеет жгутик. С другой стороны, женская гамета (яйцеклетка) является не подвижной и относительно большой по сравнению с мужской.

У людей гаметы производятся в мужских и женских гонадах. Мужские гонады — это яички, а женские гонады — яичники. Гонады также вырабатывает половые гормоны, которые необходимы для развития первичных и вторичных репродуктивных органов и структур.

Внешнее оплодотворение

Внешнее оплодотворение происходит главным образом во влажных средах и требует, чтобы самец и самка выпускали или передавали свои гаметы в окружающую их среду (обычно воду). Этот процесс также называется нерестом. Преимущество внешнего оплодотворения заключается в том, что оно приводит к производству большого количества потомков. Один из недостатков заключается в том, что экологические опасности, такие как хищники, значительно уменьшают вероятность дожить до зрелого возраста.

Амфибии, рыбы и кораллы являются примерами организмов, которые воспроизводятся с помощью внешнего оплодотворения. Животные, размножающиеся таким способом, обычно не заботятся о своем потомстве после нереста. Некоторые нерестовые животные обеспечивают различную степень защиты и ухода за яйцами после оплодотворения. Одни прячут яйца в песке, а другие переносят их в мешочках или во рту. Эта дополнительная забота увеличивает шансы потомства на выживание.

Внутреннее оплодотворение

Внутреннее оплодотворение происходит при слиянии половых клеток (гамет) самца и самки внутри репродуктивного тракта самки. Животные, которые используют внутреннее оплодотворение, специализируются на защите развивающегося яйца. Например, рептилии и птицы откладывают оплодотворенные яйца, которые покрыты защитной оболочкой, устойчивой к потере воды и повреждениям.

Млекопитающие, за исключением монотремов, шагнули на ступень выше, позволяя эмбриону развиваться в утробе матери. Такая дополнительная защита увеличивает шансы на выживание, потому что мать обеспечивает эмбрион всем, что ему необходимо для нормального развития. Фактически, большинство матерей-млекопитающих продолжают заботиться о своих детенышах в течение нескольких лет после рождения.

Самец или самка

Важно отметить, что не все животные строго делятся на самцов и самок. Животные, такие как морские анемоны, могут иметь как мужские, так и женские репродуктивные структуры; Они известны как гермафродиты. Некоторые гермафродиты способны к самооплодотворению, но большинство нуждается в партере для размножения. Поскольку обе вовлеченные стороны становятся оплодотворенными, этот процесс удваивает количество потомства, которое появится на свет. Гермафродитизм — хорошее решение проблемы нехватки потенциальных половых партнеров. Другим решением является способность менять пол от самца к самке (протэндри) или от самки к самцу (протогиния). Определенные виды рыб, например, губановые могут изменяться от самки к самцу в процессе перехода во взрослую жизнь.

Источник: natworld.info